The words contained in this file might help you see if this file matches what you are looking for:

...Next generation sequencing y r o t a b ay lt i ss er ce nv ei in cu s lg an nu oo iy tm ua ph mg oi cb problem statement map sequence reads l with variable nucleotide confidence to e c n v model reference genome that may u g be different from the subject speed m p h tens of millions gbp accuracy mismatches included repetitive regions visualization workflow indexing fast lookup possible hit locations for hashing groups have similar content k mer hash exact matches can used narrow down match sorting provides addressing gnumap uses all mers as seed points read mapping building table sliding window indexes aacca aaccat actgaaccatacgggtactgaaccatgaatggcacctatacgagatacgc catac...