Next Generation Sequencing Slideshare 66732

picture2_Next Generation Sequencing Slideshare 66732 | Ismb Presentation picture3_Next Generation Sequencing Slideshare 66732 | Ismb Presentation

117x Filetype PPTX File size 1.14 MB Source: bioresearch.byu.edu

File: Next Generation Sequencing Slideshare 66732 | Ismb Presentation

Next-Generation Sequencing y r o t a r o b ay Lt i ss er ce nv ei in cU S lg an nu oo iY t a tm ua ...

Filetype Power Point PPTX | Posted on 27 Aug 2022 | 2 years ago

Download

Partial capture of text on file.

The words contained in this file might help you see if this file matches what you are looking for:

...Next generation sequencing y r o t a b ay lt i ss er ce nv ei in cu s lg an nu oo iy tm ua ph mg oi cb problem statement map sequence reads l with variable nucleotide confidence to e c n v model reference genome that may u g be different from the subject speed m p h tens of millions gbp accuracy mismatches included repetitive regions visualization workflow indexing fast lookup possible hit locations for hashing groups have similar content k mer hash exact matches can used narrow down match sorting provides addressing gnumap uses all mers as seed points read mapping building table sliding window indexes aacca aaccat actgaaccatacgggtactgaaccatgaatggcacctatacgagatacgc catac...

Haven't found the file you're looking for? You can try sending a request file

Comment

no comments yet
Please Login to post a comment.

no reviews yet
Please Login to review.

Category: Uncategorized / Uncategorized
Posted on: 27 Aug 2022 | 2 years ago
Tag: download pptx, ismb, presentation,
Filetype: PPTX
File size: 1.14 MB
Views: 117x
Link recommended: filekonstruksi.com

Uploaded by: Wan learn

Wan learn

Related files

Share

Help

Related files

Share

Share to social media

Wan learn

Help

Login Area