jagomart
digital resources
picture1_Next Generation Sequencing Slideshare 66732 | Ismb Presentation


 158x       Filetype PPTX       File size 1.14 MB       Source: bioresearch.byu.edu


File: Next Generation Sequencing Slideshare 66732 | Ismb Presentation
next generation sequencing y r o t a r o b ay lt i ss er ce nv ei in cu s lg an nu oo iy t a tm ...

icon picture PPTX Filetype Power Point PPTX | Posted on 27 Aug 2022 | 3 years ago
Partial capture of text on file.

						
									
										
									
																
													
					
The words contained in this file might help you see if this file matches what you are looking for:

...Next generation sequencing y r o t a b ay lt i ss er ce nv ei in cu s lg an nu oo iy tm ua ph mg oi cb problem statement map sequence reads l with variable nucleotide confidence to e c n v model reference genome that may u g be different from the subject speed m p h tens of millions gbp accuracy mismatches included repetitive regions visualization workflow indexing fast lookup possible hit locations for hashing groups have similar content k mer hash exact matches can used narrow down match sorting provides addressing gnumap uses all mers as seed points read mapping building table sliding window indexes aacca aaccat actgaaccatacgggtactgaaccatgaatggcacctatacgagatacgc catac...

no reviews yet
Please Login to review.