jagomart
digital resources
picture1_Na07 Hybridizatioppt


 138x       Filetype PPT       File size 1.51 MB       Source: biology.hunter.cuny.edu


File: Na07 Hybridizatioppt
preparation of traditional nucleic acid probe amino acid sequence gly asp glu ser ser val leu ggg gac gag tcc tcc gtt ctc nucleic acid sequence codon degeneracy the nucleic ...

icon picture PPT Filetype Power Point PPT | Posted on 02 Sep 2022 | 3 years ago
Partial capture of text on file.

						
									
										
									
																
													
					
The words contained in this file might help you see if this file matches what you are looking for:

...Preparation of traditional nucleic acid probe amino sequence gly asp glu ser val leu ggg gac gag tcc gtt ctc codon degeneracy the is synthesizing deduced from oligonucleotide chemical synthesis ggggacgagtcctccgttct juang rh bcbasics labeled with radioactive p ggggacg hybridization ag tc ct c t g a ctg cc at dna target gene denaturation single colony lysed screened by cover filter paper transferring collect dissolve cell denatured autoradiography add s i b h r n u j biochip based on sample complementary hybridize each spot contains known signal appears schena microarray technology...

no reviews yet
Please Login to review.