The words contained in this file might help you see if this file matches what you are looking for:

...Preparation of traditional nucleic acid probe amino sequence gly asp glu ser val leu ggg gac gag tcc gtt ctc codon degeneracy the is synthesizing deduced from oligonucleotide chemical synthesis ggggacgagtcctccgttct juang rh bcbasics labeled with radioactive p ggggacg hybridization ag tc ct c t g a ctg cc at dna target gene denaturation single colony lysed screened by cover filter paper transferring collect dissolve cell denatured autoradiography add s i b h r n u j biochip based on sample complementary hybridize each spot contains known signal appears schena microarray technology...