jagomart
digital resources
picture1_Na07 Hybridizatioppt


picture2_Na07 Hybridizatioppt picture3_Na07 Hybridizatioppt

 99x       Filetype PPT       File size 1.51 MB       Source: biology.hunter.cuny.edu


File: Na07 Hybridizatioppt
Preparation of Traditional Nucleic Acid Probe Amino acid sequence GLY-ASP-GLU-SER-SER-VAL-LEU----- GGG-GAC-GAG-TCC-TCC-GTT-CTC--- * * * * * * * Nucleic acid sequence * Codon degeneracy The nucleic acid sequence is Synthesizing ...

icon picture PPT Filetype Power Point PPT | Posted on 02 Sep 2022 | 2 years ago
Partial capture of text on file. 

						
									
										
									
																
													
					

					
					
		
		
		
			
		
					
					
				


				
				
				

				
					
												

						
							

								
  
					    						
									The words contained in this file might help you see if this file matches what you are looking for:
									

									
...Preparation of traditional nucleic acid probe amino sequence gly asp glu ser val leu ggg gac gag tcc gtt ctc codon degeneracy the is synthesizing deduced from oligonucleotide chemical synthesis ggggacgagtcctccgttct juang rh bcbasics labeled with radioactive p ggggacg hybridization ag tc ct c t g a ctg cc at dna target gene denaturation single colony lysed screened by cover filter paper transferring collect dissolve cell denatured autoradiography add s i b h r n u j biochip based on sample complementary hybridize each spot contains known signal appears schena microarray technology...
								

							

						
	
												
				
					
					
					
			
					
				
				
		
	

	
		





	

	
				

						

						
							Haven't found the file you're looking for? You can try sending a request file
					 
							
						

						
						
						
				

														
Share

						
				
											
																										
						
				
						

							

								https://jagomart.net/item/80324/na07-hybridizatioppt
							

							
							
						

                				
				
						
				

				
						
						
						
						
				
						
						
				Comment				
				
				
				
				
						

						
						

							

        	
								

                       
									

										

			
											

											
												
												

					
																									
no comments yet
																												

														Please Login to post a comment.
																											

												
											
												                
												

												
												
												
												

														

															

																											    
																

																		no reviews yet
																																					
																			

																				Please Login to review.
																			
																		
																																			
																	                            
																																	

																													

													

												

												
					
											

										

									

								

							

						

						

						

				

				
				
				
				
				
				

				
					
										
					
				
					

					

						


							

							
														
								
				
				

					

						

					
								

										Category:  Uncategorized / Uncategorized 
										
Posted on: 02 Sep 2022 | 2 years ago
										
										
Tag:
																																		download ppt,
																								na07,
																								hybridizatioppt,
											                                        
																				
Filetype: PPT
										
File size: 1.51 MB
										
Views: 99x
										
Link recommended: filekonstruksi.com
										
										
										
										

										
Uploaded by:
										Wan learn
											

												Wan learn