jagomart
digital resources
picture1_Design Of Experiments Slideshare 66921 | Sequence Alignment 2015


 227x       Filetype PPTX       File size 1.60 MB       Source: moodle.med.lu.se


File: Design Of Experiments Slideshare 66921 | Sequence Alignment 2015
sequence alignment a way of arranging two or more sequences to identify regions of similarity shows locations of similarities and differences between the sequences an optimal alignment exhibits the most ...

icon picture PPTX Filetype Power Point PPTX | Posted on 28 Aug 2022 | 3 years ago
Partial capture of text on file.

						
									
										
									
																
													
					
The words contained in this file might help you see if this file matches what you are looking for:

...Sequence alignment a way of arranging two or more sequences to identify regions similarity shows locations similarities and differences between the an optimal exhibits most least aligned residues correspond original residue in their common ancestor insertions deletions are represented by gaps examples protein mstgavliy tsilikechampagne ggillfhrthelikeshamandeggsnns nucleotide attcgttggcaaatcgcccctatccggccttaa att tggcggatcg cctctacgggcc purpose reveal structural functional evolutionary relationship biological similar may have structure function likely ancestral annotation new modelling structures design analysis gene expression experiments types global aligns each introducing example needleman wunsch algorithm l g p s k q t r i w d n m local finds with highest density matches locally smith waterman scoring c option matrices used assign scores comparison pair characters identities substitutions amino acids assigned positive mismatches that unlikely been result evolution given negative e...

no reviews yet
Please Login to review.