The words contained in this file might help you see if this file matches what you are looking for:

...Our mtb dna on the tapestation minion fastq file records bp illumina all there are main approaches to sequencing market approach usp read achievements ideal for dominance length st generation applied by kb most primary pcr products sanger biosystems synthesis sbs drafts e g genotyping low throughput human nd cheap rapid wgs iontorrent massively parallel resequencing very high of millions genomes rd oxford single molecule in real time nanopore sms mbp field pacbio long lengths assembled piecing together small fragments into a consensus shotgun ggcaccagccagctgagccaattcatggaccagaacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctg ggcaccagccagctgagccaattcatggaccagtacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctg ggcaccagccagctgagcccattcatggaccagaacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctg first full assembly any genome from scratch de novo and its annotation is hard it s hypothesis at moment overlapping sequences extends improves evidence each base call errors occur many reasons...