jagomart
digital resources
picture1_Anexo Lucas Goiriz Tfg


 105x       Filetype PDF       File size 0.48 MB       Source: digital.csic.es


File: Anexo Lucas Goiriz Tfg
Annex I: Python code of the developed algorithm. Note that “'/home/lugoibel/ViennaRNA/interfaces/Python3'” and “'/home/lugoibel/nupack3.2.2/python'” are the absolute paths of the ViennaRNA python library ...

icon picture PDF Filetype PDF | Posted on 03 Feb 2023 | 2 years ago
Partial capture of text on file.

						
									
										
									
																
													
					
The words contained in this file might help you see if this file matches what you are looking for:

...Annex i python code of the developed algorithm note that home lugoibel viennarna interfaces and nupack are absolute paths library wrapper salis et al ii employed in this work import sys subprocess random datetime time path append rna from plotly as py offline graph objs go definition parameters start vienna mathews parameterfile read parameter file misc dna par no dangles cvar coversion into nc fact define nucleotides nucs circuit sequence names guide boltzmann function beta num e dgbp metropolis bm con converge d shadow constant components shdw s tgagatgtaaaggatgagtgagatg t cactcatcctttacatctcaaacactctattca continues on next page functions command line input system def cmdinput global userinput looping true while if u replace uniq set checks is a adequate length issubset len seqs preit false meant to be test elif tggagtgtgacaatggtgtttg exit retry previous statements else enter valid upper return none fasta saves data dictionary key header value only fileinput dict for open strip n spl...
Haven't found the file you're looking for? You can try sending a request file
Comment

no comments yet
Please Login to post a comment.

no reviews yet
Please Login to review.